Order ID:89JHGSJE83839 | Style:APA/MLA/Harvard/Chicago | Pages:5-10 |
Instructions:
PHA 6535 Nucleotide Activity Case Study Questions
I’m working on a biology multi-part question and need an explanation and answer to help me learn.
Discuss the function in detail of each of the following RNA polymerase II transcription factors.
TFIIB
TFIIE
TFIIF
TFIIH
What additional role does one of the subunits of TFIIH have during the initiation phase that involves other protein kinases? What is the end result?
Discuss in detail how the 5’ cap is formed in eukarytotic mRNAs.
What makes the 3’ end of eukaryotic mRNAs unique? Describe how this is added.
What are the five snRNAs involved in splicing reaction, and describe briefly how they work to assemble spliceosomes.
What step in de novo purine nucleotide synthesis is the first committed step, and what happens in this step? Why is the carboxylation that takes place in step 6 of the de novo purine nucleotide synthesis unusual?
Describe three major feedback mechanisms that help to regulate the overall rate of de novo purine nucleotide synthesis and the relative rates of formation of the two end products, adenylate and guanylate.
How is thymidylate derived?
What causes Lesch-Nyhan Syndrome? What is the role of the enzyme that is lacking in individuals who have this disease?
Describe the condition known as Gout and include in your discussion how it is caused
What effect does the attenuation of hypoxanthine-guanine phosphoribosyl transferase (HGPRT) have on the de novo and salvage syntheses of purines?
Explain in detail the common feature of the biosynthesis of NAD+, FAD and Coenzyme A (CoA)
Define the following terms: codon, reading frame and peptide sequence (3 points)
Review the following coding DNA Sequence and its template strand, and provide the sequence
for the corresponding mRNA strand in 5’ to 3’ orientation: (2 points)
5’-CCGGCTAAGATCTGACTAGC-3’ (coding)
3’-GGCCGATTCTAGACTGATCG-5’ (template)
Provide the 3 possible reading frames for the following mRNA sequence and identify any initiation
or termination codons (5 points)
5’- GCUAGUCAGAUCUUAGCCGG -3’
Consider the following mRNA sequence, translate each codon into its corresponding amino acid
and provide the peptide sequence: (5 points)
5’-CGG CUA AGA UCU GAC UAG -3’
RUBRIC |
||||||
Excellent Quality 95-100%
|
Introduction
45-41 points The background and significance of the problem and a clear statement of the research purpose is provided. The search history is mentioned. |
Literature Support 91-84 points The background and significance of the problem and a clear statement of the research purpose is provided. The search history is mentioned. |
Methodology 58-53 points Content is well-organized with headings for each slide and bulleted lists to group related material as needed. Use of font, color, graphics, effects, etc. to enhance readability and presentation content is excellent. Length requirements of 10 slides/pages or less is met. |
|||
Average Score 50-85% |
40-38 points More depth/detail for the background and significance is needed, or the research detail is not clear. No search history information is provided. |
83-76 points Review of relevant theoretical literature is evident, but there is little integration of studies into concepts related to problem. Review is partially focused and organized. Supporting and opposing research are included. Summary of information presented is included. Conclusion may not contain a biblical integration. |
52-49 points Content is somewhat organized, but no structure is apparent. The use of font, color, graphics, effects, etc. is occasionally detracting to the presentation content. Length requirements may not be met. |
|||
Poor Quality 0-45% |
37-1 points The background and/or significance are missing. No search history information is provided. |
75-1 points Review of relevant theoretical literature is evident, but there is no integration of studies into concepts related to problem. Review is partially focused and organized. Supporting and opposing research are not included in the summary of information presented. Conclusion does not contain a biblical integration. |
48-1 points There is no clear or logical organizational structure. No logical sequence is apparent. The use of font, color, graphics, effects etc. is often detracting to the presentation content. Length requirements may not be met |
|||
You Can Also Place the Order at www.collegepaper.us/orders/ordernow or www.crucialessay.com/orders/ordernow
PHA 6535 Nucleotide Activity Case Study Questions |
PHA 6535 Nucleotide Activity Case Study QuestionsPHA 6535 Nucleotide Activity Case Study Questions